hidden pixel

Subsequently Network

Welcome to Subsequently.net! Subsequently.net is a highly categorized in-depth informational resource for all terms related to Subsequently, Subsequence and Math. About us.


In mathematics, a subsequence is a sequence that can be derived from another sequence by deleting some elements without changing the order of the remaining elements. For example, the sequence is a subsequence of .

Given two sequences X and Y, a sequence G is said to be a common subsequence of X and Y, if G is a subsequence of both X and Y. For example, if

and

then a common subsequence of X and Y could be

This would not be the longest common subsequence, since G only has length 3, and the common subsequence has length 4. The longest common subsequence of X and Y is .

Contents

Applications

Subsequences have applications to computer science, especially in the discipline of Bioinformatics, where computers are used to compare, analyze, and store DNA strands.

Take two strands of DNA, say:

ORG1 = ACGGTGTCGTGCTATGCTGATGCTGACTTATATGCTA and
ORG2 = CGTTCGGCTATCGTACGTTCTATTCTATGATTTCTAA.

Subsequences are used to determine how similar the two strands of DNA are, using the DNA bases: adenine, guanine, cytosine and thymine.

From Wikipedia under the GNU Free Documentation License
Sat Apr 28 13:26:20 2012

Adjective

subsequent

  1. Following in time; coming or being after something else at any time, indefinitely.
    Growth was dampened by a softening of the global economy in 2001, but picked up in the subsequent years due to strong growth in China.
  2. Following in order of place; succeeding.
Derived terms

From Wiktionary under the GNU Free Documentation License
Sat Apr 28 13:26:21 2012


Bisons in coral subsequently public domain image picture
www.public-domain-image.com
Bisons in coral subsequently public domain image picture
600 x 725px

[source page]

Bisons in coral subsequently

File:Ford Pilot ca 1950 extensively restored subsequently .jpg ...
en.wikipedia.org
File:Ford Pilot ca 1950 extensively restored subsequently .jpg ...
1074 x 1789px

[source page]

restored subsequently .jpg

From Google Image Search: "subsequently"
Wed May 9 11:34:55 2012


loading video results for subsequently...
What if science found a biological origin for homosexuality, and subsequently was able to offer a treatment?
Q. I do believe that one day the scientific community will reach the consensus that homosexuality is an innate characteristic with a definite biological origin. If it is true that homosexuality is an innate characteristic, then it would be very possible for a cure or treatment. Maybe even one that could be delivered in utero, thus ensuring that no children born would ever be homosexual. However, even if all of this came to pass I don't believe it would be beneficial to society to cure the gay population. I believe that homosexuals have made, and make many valuble contributions to society, possibly because of their orientation. Though I may be wrong, I believe that homosexuality does not just dictate physical/emotional attraction, but also has… [cont.]
Asked by LazyBunny440 - Sat Apr 15 09:14:23 2006 - Lesbian, Gay, Bisexual, and Transgendered - 27 Answers - Comments

A. We are so use to being attacked by homophobes that when we first start to read this our first reaction is to attack the idea that you are saying we can be cured. But if we can continue on we will see you are making a point. Yes society is made up of many people and we should all learn to get along. Those people that say they have been cured from being homosexuals were never truly homosexuals because there is no cure and if there were I am happy with me so I will stay this way. THANKS
Answered by azgraywolf143 - Thu Apr 27 17:35:52 2006

A patient with a history of rheumatic fever has a tooth extraction and subsequently develops bacterial endocar?
Q. A patient with a history of rheumatic fever has a tooth extraction and subsequently develops bacterial endocarditis. What possible intervention could have been made at the time of the tooth extraction to reduce the risk of subsequent endocarditis?
Asked by - Sun Oct 31 00:59:34 2010 - Medicine - 2 Answers - Comments

A. Rheumatic fever often causes damage to your heart valves, especially the mitral valve. This damage makes it more likely for bacteria to be able to grow on the valves. Whenever a patient with a history of valvular damage undergoes a procedure where bacteria can get introduced into the blood (like a tooth extraction), you should give prophylactic antibiotics to prevent endocarditis.
Answered by - Sun Oct 31 05:01:17 2010

From Yahoo Answer Search: "subsequently"
Sun Apr 29 02:29:43 2012


Hedge Fund Presses Yahoo Attack
Wall Street Journal
Hedge Fund Presses Yahoo Attack
Fri, 04 May 2012 11:32:07 -0700

Yahoo subsequently said Mr. Thompson's degree from Stonehill College was just in accounting, and not in accounting and computer science , while Ms. Hart holds a business administration degree with specialities in marketing and economics.
Adam Yauch, founding member of the Beastie Boys, has died
Entertainment Weekly (blog)
Adam Yauch, founding member of the Beastie Boys, has died
Fri, 04 May 2012 10:16:40 -0700

The Brooklyn-born musician known to fans as MCA was first treated for cancerous growths in his parotid gland and a lymph node in 2009 and subsequently underwent surgery and radiation therapy, which forced the delay of the Beastie Boys' most recent ...

From Google News Search: "subsequently"
Fri May 4 13:52:43 2012

 Subsequently | Bridal Rings Blog
bridalringsblog.bloggd.org
Subsequently | Bridal Rings Blog

hypersebuah, bridalringsblog.bloggd.org
2012-04-30 22:13:53

Subsequently . Posted on April 30, 2012 by hypersebuah. The second is,office 2007 key, Ms may well take advantage of promo methodology as a result of providing the prices packages to be able to undertaking users using a number of ...

Slouching Toward Decrepitude - Some Idjit on Yahoo Answers (Who ...
pissycat.multiply.com
Slouching Toward Decrepitude - Some Idjit on Yahoo Answers (Who ...

unknown, pissycat.multiply.com
2012-04-30 21:45:23

Blog Entry, Some Idjit on Yahoo Answers (Who Subsequently Blocked Me)... Apr 30, '12 5:45 PM for everyone ...asked us all whether, quote-unquote, the world would have been a better place had Obama's mom aborted him. This was my (IMO ...

From Google Blog Search: "subsequently"
Tue May 1 17:19:12 2012


Subsequently Network, Subsequence and Math @ Subsequently.net
An informational site about Subsequently Network, Subsequence and Math.
www.subsequently.net
Thymine (Uracil, Deoxyribose, Cytosine, Acid) @ Subsequently.net
Thymine. Includes Thymidine, Dcdp, Guanine, Nucleic Acid, Nucleoside, Dadp, Guanosine Triphosphate, Ultraviolet, Adenosine and Pyrimidine information plus more ...
www.subsequently.net/thymine
Adenine Answers (Math, Guanine, Thymine, Uracil) @ Subsequently.net
What math or science activities can I put on my extracurricular activities? Q. The college that I want to go to told me that outside math/science activities are ...
www.subsequently.net/adenine/answers.htm
www.subsequently.net
http://www.subsequently.net/ http://www.subsequently.net/0_-_zero/ http://www.subsequently.net/22lr_semi_automatic_pistol/ http://www.subsequently.net/22lr_semi ...
www.subsequently.net/urllist.txt

From Bing Site Search: "subsequently"
Mon May 14 17:49:16 2012


Subsequent | Define Subsequent at Dictionary.com
dictionary.reference.com
Subsequent | Define Subsequent at Dictionary.com
Subsequently ... occurring or coming later or after (often followed by to): subsequent events; ...
dictionary.reference.com/browse/subsequent

From Bing Web Search: "subsequently"
Tue May 1 05:33:02 2012


loading local results for subsequently...



See also:
  • Math ForumMath Forum
    mathforum.org
    Features combined archive and portal to web resources, educational issues, help forums, mailing lists, and teaching materials.
  • Eric Weisstein's World of MathematicsEric Weisstein's World of Mathematics
    mathworld.wolfram.com
    Glossary of terms. Material ranges from undergraduate to research level.
  • Mathematics WeblogMathematics Weblog
    sixthform.info
    Posts mainly about math in the news or math problems of note.

Help build the largest human-edited directory on the web.
Submit a Site - Open Directory Project - Become an Editor
Tue May 1 05:34:28 2012

loading product results for subsequently...